Showing posts with label GUS. Show all posts
Showing posts with label GUS. Show all posts

Friday, April 3, 2015

Patterns of expression of Glyma09g31910 of the PLAC-8 family show potential target for improving N2 fixation by Glycine max L.

Patterns of expression of Glyma09g31910 of the PLAC-8 family show potential target for improving N2 fixation by Glycine max L.

JILLIAN C. VAUGHT
Department of Plant Biology, The University of Oklahoma, Norman, OK

3 April 2015

ABSTRACT

Plants are limited in growth and yield by nitrogen availability in the soil. Although N fertilization methods are on the rise, they are costly and energy intensive, often resulting in nitrate run off that degrades water quality. Plants such as the soybean associate with N2 fixing bacteria that convert atmospheric nitrogen into usable organic NH3+. During nodulation, the host plant responds to chemical signals from the infecting soil bacteria in order to incorporate the bacteria into root nodules for nitrogen fixation. Chemical signals, called Nod factors are recognized by the soybean plant and induce developmental changes as well as calcium spiking in root hair cells. The soybean gene, Glyma09g31910, has been shown to be highly expressed in root hairs during inoculation with symbiotic bacteria and is therefore a target gene for increasing plant N2 fixation when N is limiting in the soil. A qRT-PCR analysis of the relative abundance of Glyma09g31910 mRNA was conduct in root hairs un-inoculated and inoculated with rhizobium bacteria. Results of our qRT-PCR indicated that root hairs both inoculated and un-inoculated show high levels of Glyma09g31910 expression. The qRT-PCR results from our study strongly contrast the data mined from SoyKB, which indicates that Glyma09g31910 expression is only high in inoculated root hairs. Results from our qRT-PCR were confirmed in our transgenic roots, which used GUS reporter downstream of the Glyma09g31910 promoter to show high levels of Glyma09g31910 expression in both inoculated and un-inoculated roots. However, transgenic roots showed a different pattern of expression of Glyma09g31910 in areas of the roots that had been infected by rhizobium bacteria when compared to expression of Glyma09g31910 in un-inoculated roots. Patterns in the expression of Glyma09g31910 when associated with bacteria, emphasize Glyma09g31910 as a potential target gene for increasing the efficiency of N2 fixation in legumes.


INTRODUCTION

Nitrogen availability is a crucial factor effecting plant growth and yield. Plants alone do not possess the biochemical pathways needed to convert atmospheric N2 into N (NH3) available for plant metabolism. Popular economic crops such as corn use nitrogen from the soil with small amounts of nutrient return, causing the soil quality to become poor and subsequent crop yield to be limited (Tauer, 1989).  Methods of soil remediation are being sought in response to limited crop growth due to low soil nitrogen content. One method of soil remediation is the addition of nitrogen through fertilization, but the direct addition of nitrogen to soil comes at a high economic price (Miransari et. al, 2013). Not only is the production of nitrogen currently an energy intensive process, but increased nitrogen fertilization has led to nitrate run off that has lowered water quality (Tauer). Finding new ways to implement N remediation into soils that avoids the direct application of nitrogen has an obvious benefit both economically and ecologically.

One investigated solution to soil remediation is the leguminous soybean plant that establishes symbiotic relationships with N-fixing bacteria. Under nitrogen limiting conditions, soybean plants will form nodules associated with the infection of Bradyrhizobium japonicum, an atmospheric N2 fixing bacteria (Miransari). Rotating crops with legumes such as the soybean is already common practice to exploit the N2 fixing ability of bacteria in association with legumes (Tauer). The efficiency of soil remediation to re-introduce usable N into the soil could be greatly increased using biotechnological applications to target genes involved in the nodulation of soybean plants. One specific gene of Glycine max L that has been shown by SoyKB to have expression correlated to the infection of N fixing rhizobia bacteria is Glyma09g31910 (Joshi, 2014). Targeting Glyma09g31910 to manipulate nodulation of N2 fixing relationships with rhizobia could be advantageous to soil remediation.  

Investigation into the evolution of Glyma09g31910 shows it belongs to a highly conserved family of proteins called PLAC-8, which can be found widespread in eukaryotes (Abba et. al, 2011). Proteins containing the PLAC-8 domain have been shown to confer cadmium resistance, regulate cell size and number, control cell growth, and promote cell division (Di Vietro, et. al, 2014).  However, despite the numerous works compiled regarding the PLAC-8 family, no definite function is attributed to this domain (Di Vetro). In a Blast protein sequence similarity search, Glyma09g31910 was found to have 99% similarity with a protein for plant cadmium resistance in Glycine soja and a 62% similarity to a predicted occurrence of cell number regulation in Cicer arietinum (NCBI Resource Coordinators). Further investigation into the PLAC-8 family could help reveal a function associated with this domain.

Although no known function is attributed to the PLAC-8 domain, preliminary evidence suggests that Glyma09g31910 is associated with the process by which rhizobacteria infects roots. The mechanism by which B. japonicum, a rhizobacteria, associates with soybean to fix N2 has been outlined in detail (Oldroyd and Downie, 2008). Research shows that upon root hair infection by the rhizobium, the bacterium secretes lipochitosaccharide-based signal molecules called Nod factors. These Nod factors begin a cascade of biochemical signals, including Ca2+ spiking that is essential for the expression of many soybean genes involved in nodulation (Geurts et. al, 2005). Gaining a better understanding of soybean genes involved in nodulation could be a target for gene modification and plant breeding to increase N2 fixation.

Preliminary results obtained from mining SoyKB indicate that Glyma09g31910 is significantly involved in the nodulation and infection of roots and root hair cells (Figure 1). Data from SoyKB shows high levels of expression of the Glyma09g31910 gene in root hairs when inoculated with rhizobacteria after a period of 12, 24, and 48 hours. Additional literature also indicates that the Glyma09g31910 gene of Glycine max L. shows strong response in terms of gene expression when inoculated with the nitrogen-fixing bacterium B. japonicum (Libault et. al, 2010). These preliminary results lead us to hypothesize that roots inoculated with B. japonicum will express Glyma09g31910 in relatively high mRNA abundance and un-inoculated roots will not show expression of Glyma09g31910. We also expect high patterns of activity of the Glyma09g31910 promoter at sites of rhizobacterial infection and nodulation in the roots and root hair cells of Glycine max L.


Figure 1. Glyma09g31910 Gene Expression in Root Hair Tissue Hours After Rhizobium Bacterial Inoculation



















Figure 1. Gene expression obtained from SoyKB is measured in RPKM found in different tissues, some inoculated with rhizobia bacteria (IN) and other un-inoculated (UN) over a period of time. The y-axis represents reads per kilobase pair per million (RPKM), the amount of short sequences produced during a PCR using specific primers to detect the presence of cDNA that has been reverse transcribed from mRNA of Glyma09g31910. The mean density of reads present is related to cDNA present at the time of mRNA extraction. Reads per kilobase pair per million normalizes the samples in terms of abundance of transcripts so it can be compared across all tissues. In the red bars at 12 hours, un-inoculated (UN) root hairs (RH) show zero abundance of transcript, while inoculated (IN) root hairs show a significant relative abundance. Root hairs inoculated and un-inoculated after 24 hours, and 48 also show highest gene expression under inoculated conditions. Tissue from the nodules shows the highest gene expression. Apical meristem, flower, green pods, leaves, and root tips show no gene expression. Roots, however, are seen to express Glyma09g31910.


RESULTS

Glyma09g31910 is highly expressed in root hair tissues when inoculated with N2 fixing bacteria such as B. japonicum according to the data mined from SoyKB. To confirm these results, mRNA was extracted from 6 major soybean Glycine max L. tissues: pods, nodules, leaves, shoot apical meristem (SAM), and stems. Samples of tissues were taken from root hairs and roots inoculated and un-inoculated with bacteria. Gel electrophoresis was used to determine the integrity of the RNA extraction from tissues (Figure 2).



Figure 2. Gel Electrophoresis of mRNA Extractions to Determine Integrity and Quality of RNA












Figure 2. Lanes 1 was RNA extracted from SAM, 2 from Stems, 3 from Leaves, 4 from Nodules, 5 from roots, and lane 6 extracted from PODS. Gel electrophoresis images on the right and left are the same with the right image adjusted for contrast to show brighter banding. RNA extracted from SAM, Stems, Leaves, Roots, and Pods show banding for smaller nucleic acid molecules consistent with RNA, however the Nodules extraction in lane 4 shows a banding of a large nucleic acid molecule more consistent with DNA contamination. Smearing in the bands indicates the presence of some protein contamination.

RNA extractions confirmed by gel electrophoresis were used to determine relative expression levels of our Glyma09g31910 gene of interest across all six tissue samples. Reverse transcription of mRNA to synthesize cDNA provided us with DNA material to run a qRT-PCR in order show the relative abundance of mRNA extracted from our tissues. To indicate the presence of our gene of interest during our qPCR, primers were ordered specific to the 5’ un-translated region of Glyma09g319190 (Fig. S4). Un-translated regions are less likely to be conserved and are therefore more likely to be more specific to our gene of interest (Fig. S5). Primers were used during qRT-PCR with SYBR Green fluorescence to indicate the relative abundance of Glyma09g31910 across all tissues. The relative abundance of mRNA was normalized using cons6, a gene of constant transcription levels across all tissues. qRT-PCR results (Table 1.) indicated highest levels of Glyma09g31910 in un-inoculated root hairs after a 12 hour incubation, and the second most relative abundance in root hairs that were inoculated with bacteria after 12 hours. Glyma09g31910 was also relatively abundant in nodules and shoot apical meristems.


Table 1. Abundance of mRNA in Tissues of Soybean Obtained from qRT-PCR











Table 1. Indicates the number of cycles that are needed to acquire the same amount of cDNA in each plant tissue using qRT-PCR. The lowest cycle value indicates the highest abundance of cDNA present in the tissue samples. The cDNA is made from the Glyma09g31910 mRNA that has been transcribed in the tissues. The lowest cycle value from RH-BAC 12HAI (the root hairs un-inoculated with bacteria after 12 hours) indicates that Glyma09g31910 has the highest expression in this tissue. RH+BAC 12 HAI followed by nodules and shoot apical meristem (SAM) have increasing levels of Glyma09g31910 expression. No Glyma09g31910 expression was found in all tissues indicated with a cycle number of 0, indicated as no amplification in the table, because no cDNA could be amplified during the qRT-PCR of cDNA made from the mRNA extracted from these samples.

Although our qRT-PCR results (Table 1) strongly contrasted the presence of Glyma09g31910 in un-inoculated root hair tissues from the SoyKB data (Figure 1), the pattern of Glyma09g31910 expression during bacterial inoculation and subsequent nodule development analyzed by a reporter gene can still be useful. In order to look at patterns of expression of the gene across the roots and root hairs, we used the Gateway system to clone the Glyma09g31910 promoter upstream of a GUS reporter. This construct was inserted into soybean plants to transform our roots. To do this, soybean plants were transformed using Agrobacteria rhizogene containing a plasmid for our promoter upstream of a GUS reporter. Agrobacteria rhizogene carrying our vector of interested infected wounds in our soybean plants and inserted our vector with the promoter cloned upstream our GUS reporter to create transgenic soybean roots.

To clone the promoter upstream of the GUS reporter sequence, the promoter was isolated from extracted gDNA. Gel electrophoresis was used to determine the integrity and quality of extracted gDNA (Figure 3). The extracted gDNA was used as DNA template for a subsequence PCR reaction using primers specific to the promoter sequence that also included 50% of attB1 and attB2 boxes that added to the promoter sequence during PCR to make the promoter sequence compatible with the Gateway system (Fig. S6). Adaptors of the attB1 and attB2 boxes were added to elongate the boxes to 100% length in a second PCR reaction (Fig. S7).


Figure 3. Gel Electrophoresis of gDNA to Determine Integrity and Quality of Extraction



















Figure 3. Gel electrophoresis of gDNA extractions was used to determine the integrity and quantity of gDNA. Lane 6 is the extraction used for Glyma09g31910 promoter isolation. It shows good quality and integrity having a solid band of large nucleic acid materials consistent with extracted DNA.

After modified primers added full length attB boxes to the Glyma09g31910 promoter, the promoter was compatible to be used with the Gateway cloning system to clone the promoter upstream of the GUS reporter. A BP reaction was used to make a recombinant pDONR/Zeo plasmid, which cloned our promoter into the pDONR plasmid. pDONR/Zeo plasmids were transformed into E. coli and allowed to grow on nutrient broth plates. Two forms of selection were used to select positive clones: ccdB gene and zeocin antibiotic resistance gene. Positive clones contained the promoter in the place of ccdB, a gene that inhibits bacterial growth. Transformed E.coli was grown on a nutrient solution containing the antibiotic, zeocin. Positive transformed clones contained the gene for zeocin resistance and were able to grow on the plate. E. coli colonies were used as PCR template and run by gel electrophoresis with primers for the Glyma09g31910 promoter to identify positive clones (Figure S8). These plasmids were extracted from positive colonies. An LR reaction was used to make a recombination of the promoter sequence into a donor vector, pYXT1/Kanamycin, containing a GUS reporter downstream the promoter. The donor vector was transformed into Agrobacterium by electroporation and grown on a nutrient plate containing kanamycin antibiotic. Two forms of selection were also used to select positive clones: the ccdB gene and antibiotic resistant gene for kanamycin. A PCR reaction followed by gel electrophoresis, using primers for the Glyma09g31910 and the reporter gene, were used to confirm the presence of positive clones for Glyma09g31910 promoter upstream the GUS reporter (Figure S9).

Agrobacterium rhizogenes uses horizontal gene transfer to infect plants. Agrobacteria transformed with our construct of interest was used to infect plants at wound sites of cut stems on our soybean plants. Soybean plants, with stems cut above the beginning of our roots, were placed in Fibrgro®cubes. The cubes were soaked with transformed agrobacterium nutrients, allowing the agrobacterium to infect the plant and transfer our construct of interest into the plant roots. Plants were grown for 5 weeks in an ultrasound aeroponic system. After this time, roots were stained with GUS staining buffer. The GUS reporter gene, when activated by the Glyma09g31910 promoter, produces β-glucuronidase. β-glucuronidase can be cleaved by X-Gluc, a substrate in the GUS staining buffer, to produce a blue stain. The blue staining observed in transformed plant roots indicates the activity of the Glyma09g31910 promoter in plants that were un-inoculated and inoculated with B. japonicum (Figure 4a-b
Figure 4a. Transformed Roots and Root Hairs Un-Inoculated and Stained with GUS Staining Buffer












Figure 4a. Roots and root hairs of un-inoculated transformed roots stained with GUS staining buffer. The image on the left is taken at 1x magnification showing blue staining of the GUS reporter gene downstream the Glyma09g31910 promoter. Blue stain indicates activity of the Glyma09g31910 promoter. The image on the right was taken at 8x magnification and shows the presence of root hairs with Glyma09g31910 activity. Root hairs appear uncurled as we would expect under un-inoculated conditions.

Figure 4b. Transformed Roots and Root Hairs Inoculated with B. japonicum and Stained with GUS Staining Buffer












Figure 4b. Roots and root hairs of inoculated transformed roots stained with GUS staining buffer. The image on the left is taken at 1x magnification showing blue staining of the GUS reporter gene downstream the Glyma09g31910 promoter. Blue stain indicates activity of the Glyma09g31910 promoter. Blue stain appears spotted which would indicate areas of rhizobacteria infection, which we would expect to activate the Glyma09g31910 promoter. The image on the right was taken at 8x magnification and shows the presence of root hairs with Glyma09g31910 activity. Root hairs appear curled, as we would expect under inoculated conditions.

Based on preliminary evidence obtained from SoyKB data mining, we would expect our Glyma09g31910 gene only to be expressed under inoculated conditions. Images of the stained un-inoculated roots and root hairs (Figure 4a) show significant blue staining which indicates the Glyma09g31910 was activated in these roots. In the image, dark tips can be seen in the 1x image that we would expect to find consistently with the activation of Glyma09g31910 during nodulation. The image of root hairs obtained at 8x does not show curling which would indicate that these root hairs have not been contaminated with rhizobacteria although they do show Glyma09g31910 activation. The results of blue staining in these un-inoculated root images dos not support the preliminary evidence obtained from SoyKB.

Although we did not expect Glyma09g31910 expression in un-inoculated root hairs based on SoyKB, the qRT-PCR results we obtained from un-inoculated root hair tissue (Table 1) indicated the highest amounts of mRNA transcripts of Glyma09g31910, and therefore high expression of Glyma09g31910 even in un-inoculated root hairs. Based on our qRT-PCR data, the staining results from the image of un-inoculated root hairs (Figure 4a) are consistent with the data we obtained (Table 1).

Images of root hairs under inoculated conditions (Figure 4b) appear to have spotted blue staining along the roots in the 1x image. The image taken of the root hairs at 8x have solid blue staining on both sides of the root and in the root hairs. The root hairs in the image appear curled as would be expected as a result of B. japonicum infection. If Glyma09g31910 activity is indeed a response exclusive to rhizobacterial infection, then the blue spots along the transgenic roots indicate areas where rhizobium bacteria entered and infected the roots.

Data analysis from SoyKB indicating that Glyma09g31910 is only expressed under inoculated conditions is supported in the images of the inoculated roots and root hairs (Figure 4b). Unfortunately, because both inoculated and un-inoculated roots show blue staining for Glyma09g31910 activity, our experimental results show no evidence that Glyma09g31910 is expressed exclusively in response to rhizobium bacterial infection. Interestingly, our results of heavy blue staining in un-inoculated roots and slightly less blue staining in inoculated roots agrees with our qRT-PCR results (Table 1) showing the highest amounts of mRNA of Glyma09g31910 in un-inoculated root hairs and slightly less Glyma09g31910 mRNA extracted from inoculated root hairs.

It is important to note the difference in the appearance in the staining of the inoculated and un-inoculated root hairs. While un-inoculated roots appear to have continuous staining down the length of each transgenic root, inoculated roots have spotted staining which is more consistent with sites of infection by rhizobacteria. The difference in these staining patterns could help indicate that the staining of the un-inoculated roots was not due to contamination of rhizobacteria and possibly pertains to issues in the protocol for root staining. Due to the contradiction of our experimental results and data provided by SoyKB, a replication of this experiment would be needed to defend our experimental results with confidence. Replication of this experiment is also needed to confirm that images labeled inoculated and un-inoculated are in fact labeled correctly and were not switched when they were taken back to the lab for analysis, as there was some confusion between group members about the separation of inoculated and un-inoculated plants.

Discussion
A growing worldwide population presents long-term challenges for the production of food crops.
It is estimated that every day, the United States loses 3,000 acres of productive farmland to a variety of developments, both urban and industrial (Land Use Overview, 2013). Loss of cultivatable farmland must be met by advancements in farming techniques such as gene manipulation in crops.

Many common food crops tend to use up nitrogen very readily from the soil, leaving the soil nitrogen deficient. These nitrogen-draining crops tend to fruit and be leafy such as tomatoes, lettuce, and cabbage (Indrasumunar, 2012). Crops grown in nitrogen deficient soil tend to display reduced biomass, decreased growth rates, and increased oxidative damage (Rubio-Wilhelmi, 2011). This reduction in crop yield due to nitrogen deficient soil is of deep concern for farmlands that must meet the growing demand for crop yields.

Fortunately there are crops, such as our soybean, that are able to re-establish useable nitrogen concentrations into the soil by their association with nitrogen fixing bacteria. This trait, indicative of legumes, shows potential to be exploited by biotechnological applications. Genes that prove to be involved in the processes of nitrogen fixation through rhizobacterial association are clear targets for gene manipulation.

Data mined from SoyKB shows clear evidence that Glyma09g31910 has some expressive response to rhizobacterial inoculation soon after inoculation. Although our results failed to clearly support these findings, it is still reasonable to conclude that Glyma09g31910 is involved in the root hair association with nitrogen fixing bacteria, specifically nodulation. Previous studies indicate that genes from the PLAC-8 family may be involved in cell division and remodeling, which would be a consistent with the morphological response of nodulation following bacterial infection with N-fixing bacteria.

Poor conformation of SoyKB data for gene expression in our own experiment could be due to mRNA contamination across our plates prior to qPCR. Impurities in our RNA such as gDNA contamination in our cDNA would also produce the expression patterns seen for Glyma09g31910 in un-inoculated root hairs (Table 1). There is much more uncertainty as to why our transformed roots showed consistent Glyma09g31910 promoter expression under un-inoculated conditions and for this reason it would be beneficial to carefully repeat this experiment. 

High relative abundance of Glyma09g31910 mRNA in nodules and inoculated root hairs is however consistent with our expected results because this gene has been shown to be involved in Nod Factor responses to N-fixing bacteria which occurs in nodules (Geurts). It would be interesting to further investigate the relative abundance of Glyma09g31910 mRNA in nodulation across time points of nodulation from the initial infection to the time of non-expanding nodules. Investigation into the development of nodulation would tell us more about the stages of nodulation that Glyma09g31910 is involved in.

It is worthwhile to remark that high relative abundance of Glyma09g31910 gene transcript is also seen in shoot apical meristems (Table 1). Expanding meristematic tissues are constantly involved in cell division and remodeling. Expression of Glyma09g31910 in dividing cells would provide evidence that the expression of Glyma09g31910 is not only specific to accommodating bacterial infection but also to other types of cell division and remodeling that is being exploited by bacterial infection for the purpose of nodulation. Nevertheless targeting Glyma09g31910 for gene manipulation in efforts to increase legume association with nitrogen fixing bacteria or to exploit its possible role in cell division and nodulation could be profitable strategies for improving crop yield and nitrogen fixing efficiency.

Materials and Methods

Soybean Selection of Tissues
Six major tissues of soybean (Glycine max L.) were chosen for the extraction of gDNA and mRNA. Healthy tissues from pods, roots, nodules, leaves, stems, and shoot apical meristem (SAM) were chosen and homogenized using the beadbeating method. Cell disrupted material was frozen and stored at -80 degrees C. Two types of root tissues were used for mRNA extraction: roots inoculated with B. japonicum and roots un-inoculated with B. japonicum.

Primer Design
Primers were designed for qPCR to indicate presence of Glyma09g31910 gene and to isolate our promoter region for the Gateway method. The soybean genomic resource www.phytozome.net was used to acquire our cDNA sequence of Glyma09g31910. SoyKB at www.soykb.org was used to characterize the expression pattern of this gene. The following parameters were used to choose the qRT-PCR primer: a size of 19-23 base pairs, a PCR product size between 80-120 base pairs, an annealing temperature of the primer at an optimal 60 degrees C, and the percentage of GC content of the primer to be from 40-60%. The forward primer was ordered from Integrated DNA Technologies (IDT) and was 22 bases; the reverse primer was 20 bases. The primers were chosen from the 5’ un-translated region.

Primers were also designed for the isolation of the Glyma09g31910 promoter. The sequence of the promoter was also found using www.phytozome.net and then the promoter region determined using SoyKB. The parameters for the promoter primers were as follows: 19-23 base pairs with an optimal of 21 base pairs, a PCR product size around 2000 base pairs upstream the first codon, annealing temperature at an optimal 60 degrees C, and the GC content 40-60%. The forward primer ordered was 40 base pairs with a GC content of 27.5% and the reverse was 35 base pairs with a GC content of 42.9%. The primers for the promoter included 50% of the attB1 and attB2 boxes used for recombination during the Gateway System Protocol.

gDNA Extraction
Genomic DNA was extracted from soybean tissue before mRNA extraction to avoid contact with DNase. gDNA was extracted from frozen cell disrupted homogenized material according to DNeasy Plant Mini Kit (http://learn.ou.edu/d2l/le/content/2166077/viewContent/2934007/View). After extraction and concentration readings, gDNA was stored at 20 degree C until further use.

mRNA Extraction
mRNA was extracted from frozen cell disrupted homogenized tissue of pods, roots, nodules, leaves, stems, and shoot apical meristem (SAM). The extraction protocol was RNA Mini Kit (Plant) Protocol (http://learn.ou.edu/d2l/le/content/2166077/viewContent/2934007/View). mRNA extracted from the six plant tissues was used to synthesize cDNA using reverse transcription.

gDNA and mRNA Extraction Concentrations Measurements
gDNA and mRNA extraction concentrations were measured using NanoDrop 2000 technology. Two microliters of the extraction sample was pipetted onto the machine and measured using light absorption spectrums. The machine yielded concentration and purification measurments.

Gel Electrophoresis to Confirm gDNA and mRNA Extraction
A gel was made from Buffer and agrose. gDNA and mRNA were run on separate gels with loading dye and water. After 20 minutes the gels were removed and analyzed for the presence of gDNA and mRNA bands to confirm our extractions.

cDNA Synthesis using Reverse Transcription
The Reverse Transcription Protocol (http://learn.ou.edu/d2l/le/content/2166077/viewContent/2934035/View) was used for all six mRNA extractions across all selected tissues to synthesize cDNA for qPCR.

Quantitative PCR of cDNA
Quantitative PCR was performed using the previous cDNA extractions as DNA template. qPCR was performed according the Quantitative PCR Protocol  (http://learn.ou.edu/d2l/le/content/2166077/viewContent/2934011/View). The forward and reverse primers ordered from IDT for qPCR were used to indicate the concentrations of Glyma09g31910 present. Primers were originally lyophilized and water was added to re-suspend primers to 100 mM. After 40-45 PCR cycles, SYBR Green fluorescent dye intensity was measured by a standard dissociation curve program.

PCR of gDNA to Isolate Promoter and Attach attB Boxes
PCR was performed to amplify the promoter sequence while adding 50% of the attB1 and attB2 boxes to each end. Primers ordered from IDT were re-suspended using water and were added to the extracted gDNA. Water, Buffer, Taq polymerase, and dNTPs were also components of the reaction. The final product was the promoter sequence containing 50% of attB1 and attB2 boxes on each side, now compatible for the Gateway System.

A second PCR amplification was run with our promoter sequence using attB1 and attB2 box adaptors to extend the B boxes to their full length. To precipitate the promoter DNA, PEG Precipitation Protocol was used (http://learn.ou.edu/d2l/le/content/2166077/viewContent/2952308/View). Once extended and isolated, promoters were compatible for recombination into pDONR/Zeo plasmid.

BP Clonase Reaction
BP Clonase Protocol (http://learn.ou.edu/d2l/le/content/2166077/viewContent/2952308/View) from Invitrogen was used to produce recombinant pDONOR/Zeo vector to introduce the promoter into the plasmid. Heat shock protocol (http://learn.ou.edu/d2l/le/content/2166077/viewContent/2961459/View) was used to transform E. coli with the promoter containing pDONOR/Zeo plasmid. Transformed E. coli was allowed to recover in SOC media (without antibiotic) and grow for 45 minutes.

Positive Clone Selection of Transformed E. coli Colonies
Transformed E. coli was plated onto LB agar plates that contained Zeocin. E. coli that had been transformed with plasmids that were not recombinant contained the selective ccdB gene that inhibits cell growth and did not grow on medium. E. coli that was not transformed did not grow on plates because it did not contain pDONOR/Zeo plasmid that has the gene for Zeocin resistance. E. coli colonies growing on the LB agar plates + Zeocin were confirmed to contain the Glyma09g31910 promoter using PCR with primers from our forward “screen” and our reverse attB2 box primer ordered from IDT (Fig. S1). The PCR product was analyzed using gel electrophoresis and a band around 533 base pairs was expected. The absence of bands in the gel (Fig, 2S) indicates that the “screen” did not anneal to the Glyma09g31910 promoter at 60 degrees C. Two new screen sequences were ordered from IDT to confirm the presence of the promoter and reporter after the LR Clonase reaction.

Although no colonies were confirmed to contain the promoter, two large colonies were transferred to LB culture and grown overnight in order to generate many plasmids within E. coli for extraction.

Plasmid Extraction from E. coli
Plasmids were extracted from the E. coli that had been incubated and grown overnight. Plasmids were extracted according to E.Z.N.A. Plasmid DNA Mini Kit I Protocol (http://learn.ou.edu/d2l/le/content/2166077/viewContent/2928234/View). Plasmids contain a sequence of attBP1 and AttBP2 boxes sequence flanking the promoter that is recognized by the LR Clonase enzyme.

LR Clonase Reaction
Plasmids containing the promoter extracted from E. coli underwent a reaction using LR Clonase protocol (http://learn.ou.edu/d2l/le/content/2166077/viewContent/2957702/View). LR Clonase reaction  produced recombinant pYXT1 donor vector containing the promoter upstream of  the GUS reporter. pYXT1 donor vectors contain the kanamycin resistant gene.

Electroporation of Agrobacterium rhizogenes strain K599 with pYXT1 Donor Vectors
Electroporation was performed according the Blue Electroporation-Competent Cell Protocol (http://learn.ou.edu/d2l/le/content/2166077/viewContent/2961455/View) from Stratagene. Electroporation transformed Agrobacterium to take up pYXT1 donor plasmids containing the kanamycin resistant gene.

Positive Clone Selection of Transformed Agrobacterium rhizogenes Colonies
Transformed Agrobacterium was allowed to recover in SOC medium and then plated onto LB agar plates containing kanamycin. Colonies were allowed to grow overnight incubating at 37 degrees C. Colonies were selected and used as DNA template for PCR to amplify 300 base pairs between two screens, the first from the promoter and the second from the reporter downstream of the promoter insertion. Gel electrophoresis shows positive bands for the promoter and reporter fusion around 300 base pairs (Fig S3).

Soybean Transformation
The soybean plants were transformed with Agrobacteria rhizogene containing the promoter upstream to the Gus reporter. Soybean plants were cut with ethanol sterilized scissors above the true leaves. Soybean cuts were inserted into Fibrogro cubes. Four mL. of A. rhizogenes was pipetted onto the cubes. Soybean cuts in A. rhizogenes absorbed cubes were covered and incubated at room temperature allowing roots to grow from the cubes. After 5 weeks, transgenic soybean plants were transferred to 3 parts vermiculite 1 part perlite mixture. Half of our transgenic plants were inoculated with B. japonicum and the others remained un-inoculated. After five weeks, the roots were scored for nodules.

GUS Staining
GUS staining buffer was made with X-Guc to reveal the presence of the substrate using a GUS Histochemical Assay with protocols located on D2L (http://learn.ou.edu/d2l/le/content/2166077/viewContent/2984222/View). Five week old transformed plant roots were cut from the soybean plant and incubated in the GUS staining buffer for 30 minutes. Roots were incubated overnight at 37 degrees C. Chemical reaction was then stopped and roots were stored at 4 degrees C until they could be observed under a microscope.


Supplemental Figures

Glyma09g31910 Promoter With Highlighted Screen and attB1 Forward and attB2 Reverse Primers





















Fig. S1. The first yellow highlighted region (TTGTGTGCATTAAGTTGTGAGC) is the attB1 Forward Primer ordered from Integrated DNA Technologies (IDT). The second green highlighted region (GTGAGTGTGGCATCATTATTAAC) is the “screen” primer ordered from IDT. The last yellow highlighted region (TTTGTCTCTGATTAGAGCTTCAAA) is the attB2 Reverse Primer region ordered from IDT. The green highlighted “screen” primer did not amplify and the gel electrophoresis after PCR using the screen primer and the attB2 reverse showing no banding is shown in Figure S2.

Gel Electrophoresis for Selection of Positive E. coli Clones Containing Glyma09g31910 Promoter







Fig. S2. Gel Electrophoresis of G1-12 and H1-4 do not show banding for a product isolated from the promoter to be around 533 base pairs. This indicates our primers did not anneal at the temperatures we used for PCR. As a result of this gel, two new screens were ordered to confirm the presence of the promoter in the pYXT1 plasmid.

Gel Electrophoresis for Selection of Positive Agrobacterium rhizogenes Colonies Recombination with Glyma09g31910 Promoter









Fig. S3. Gel electrophoresis of all columns was taken from the PCR of transformed A. rhizogenes colonies containing Glyma09g31910 promoter. Two new primers were ordered, one within the promoter region and the second within the reporter region. Bands were consistent with a PCR product around 300 base pairs, which was expected from the two new ordered primer “screens” from IDT.

Forward and Reverse Primers for qPCR of cDNA




Fig. S4. Forward and Reverse Primer sequences ordered from Integrated DNA Technologies (IDT). Primers were used to amplify the regions of DNA located between these two primers. The specificity of the primers allow us to infer that an abundance of the amplified product is related to the amount of original mRNA present in the tissues before cDNA synthesis.

Glyma09g31910 Gene Sequence









Fig. S5. Glyma09g31910 gene sequence was acquired using www.phytozome.net. The green region is an area of 5’ un-translated region from which the primers for qPCR were ordered. The genomic sequence is 1416 nucleotides.

Primers Used to Isolate Promoter Sequence and add attB1 and attB2 Boxes



Fig. S6. Glyma09g31910 promoter specific primers with 50% of attB1 and attB2 boxes attach for Gateway System compatibility.

attB1 and attB2 Adaptors to add Full Length Boxes to the Promoter



Fig. S7. attB1 and attB2 adaptors were used in subsequence PCR to amplify the complete boxes to be compatible with the Gateway system.

Gel Electrophoresis Primers for Positive E. coli Transformed Clones








Fig. S8. Gel electrophoresis was run with primers for the Glyma09g31910 promoter insertion into E. coli donor vectors. Columns G1-12 and H1-4 were each colonies of E. coli selected as template for PCR. The gel did not indicate definite bands of expected size and ccdB gene exchange and zeocin resistance selection was used to determine that colonies were, in fact, transformed. New primers were ordered with greater specificity to amplify Glyma09g31910 promoter region for future selections.


Gel Electrophoresis with Primers for Positive Transformed Clones




















Fig. S9. Gel electrophoresis was run with primers for Glyma09g31910 promoter and Gus reporter gene. Columns JV_k and JV_m show two positive colonies containing transformed bacteria to be selected for agrobacteria transformation. Two distinct bands of expected size can be seen to determine that the Glyma09g31910 gene of interest was inserted upstream the GUS reporter.


REFERENCES

Abba, S., Vallino, M., Daghino, S., Vietro, Di L., Borriello, R., and Perotto, S. (2011) A PLAC8-containing protein from an endomycorrhizal fungus confers cadmium resistance to yeast cells by interacting with Mlh3p. Nucleic Acid Research 39 (17): 7548-7563.
DI Vietro, Luigi, Daghino, Stefania, Abba, Simona, and Perotto, Silvia. (2014) Gene expression and role in cadmium tolerance of two PLAC8-containing proteins identified in the ericoid mycorrhizal fungus Oidiodendron maius. Fungal Biology 118: 695-703.
Geurts, R., Fedorova, E., and Bisseling, T. (2005) Nod factor signaling genes and their function in the early stages of Rhizobium infection. Elsevier. Current Opinions in Plant Biology 8:346-352.
Indrasumunar, A., Menzies, N. W., & Dart, P. J. (2012). Calcium affects the competitiveness of acid-sensitive and acid-tolerant strains of Bradyrhizobium japonicum in nodulating and fixing nitrogen with two soybean cultivars in acid soil. Soil Biology and Biochemistry, 46, 115-122.
Joshi, T., Fitzpatrick, M. R., Chen, S., Liu, Y., Zhang, H., Endacott, R. Z., ... & Xu, D. (2014). Soybean knowledge base (SoyKB): a web resource for integration of soybean translational genomics and molecular breeding. Nucleic acids research, 42(D1), D1245-D1252
Land Use Overview (2013).  U.S. Environmental Protection Agency. http://www.epa.gov/agriculture/ag101/landuse.html
Libault, M., Zhang, X.C., Govindarajulu, M., Qui, J., Ong, Y.T., Brechenmacher, L., Berg, R. H., Hurley-Sommer, A., Taylor, C.G., and Stacey, G. (2010) A member of the highly conserved FWL (tomatoe FW2.2-like) gene family is essential for soybean nodule organogenesis. The Plant Journal 62, 852-864.
Miransari, M., Riahi, H., Eftekhar, F., Minaie, A., and Smith, D.L. (2013) Improving soybean (Glycine max L.) N2 Fixation under Stress. J Plant Growth REgul 32:909-921.
NCBI Resource Coordinators (2015) "Database resources of the National Center for Biotechnology Information”
Oldroyd, Giles ED, and J. Allan Downie. "Coordinating nodule morphogenesis with rhizobial infection in legumes." Annu. Rev. Plant Biol. 59 (2008): 519-546.
Rubio-Wilhelmi, M. M., Sanchez-Rodriguez, E., Rosales, M. A., Begona, B., Rios, J. J., Romero, L., ... & Ruiz, J. M. (2011). Effect of cytokinins on oxidative stress in tobacco plants under nitrogen deficiency. Environmental and Experimental Botany, 72(2), 167-173.
Tauer, Loren W. (1989) Economic impact of future biological fixation technologies on United States agriculture. Kluwer Academic Publishers. Plant and Soil 119, 261-270.

endron maius. Fungal Biology 118: 695-703.
Geurts, R., Fedorova, E., and Bisseling, T. (2005) Nod factor signaling genes and their function in the early stages of Rhizobium infection. Elsevier. Current Opinions in Plant Biology 8:346-352.
Indrasumunar, A., Menzies, N. W., & Dart, P. J. (2012). Calcium affects the competitiveness of acid-sensitive and acid-tolerant strains of Bradyrhizobium japonicum in nodulating and fixing nitrogen with two soybean cultivars in acid soil. Soil Biology and Biochemistry, 46, 115-122.
Joshi, T., Fitzpatrick, M. R., Chen, S., Liu, Y., Zhang, H., Endacott, R. Z., ... & Xu, D. (2014). Soybean knowledge base (SoyKB): a web resource for integration of soybean translational genomics and molecular breeding. Nucleic acids research, 42(D1), D1245-D1252
Land Use Overview (2013).  U.S. Environmental Protection Agency. http://www.epa.gov/agriculture/ag101/landuse.html
Libault, M., Zhang, X.C., Govindarajulu, M., Qui, J., Ong, Y.T., Brechenmacher, L., Berg, R. H., Hurley-Sommer, A., Taylor, C.G., and Stacey, G. (2010) A member of the highly conserved FWL (tomatoe FW2.2-like) gene family is essential for soybean nodule organogenesis. The Plant Journal 62, 852-864.
Miransari, M., Riahi, H., Eftekhar, F., Minaie, A., and Smith, D.L. (2013) Improving soybean (Glycine max L.) N2 Fixation under Stress. J Plant Growth REgul 32:909-921.
NCBI Resource Coordinators (2015) "Database resources of the National Center for Biotechnology Information”
Oldroyd, Giles ED, and J. Allan Downie. "Coordinating nodule morphogenesis with rhizobial infection in legumes." Annu. Rev. Plant Biol. 59 (2008): 519-546.
Rubio-Wilhelmi, M. M., Sanchez-Rodriguez, E., Rosales, M. A., Begona, B., Rios, J. J., Romero, L., ... & Ruiz, J. M. (2011). Effect of cytokinins on oxidative stress in tobacco plants under nitrogen deficiency. Environmental and Experimental Botany, 72(2), 167-173.

Tauer, Loren W. (1989) Economic impact of future biological fixation technologies on United States agriculture. Kluwer Academic Publishers. Plant and Soil 119, 261-270.